View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921_high_74 (Length: 248)
Name: NF5921_high_74
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921_high_74 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 42451806 - 42452046
Alignment:
| Q |
1 |
tgatcttgttgaaatcaatctcttcttattcgtaaagatagtcagagcccgaaatttgtttgcacataatggccataacaatttggatccttatgtggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42451806 |
tgatcttgttgaaatcaatctcttcttattcgtaaagatagtcagagcccgaaatttgtttgcacataatggccataacaatttggatccttatgtggag |
42451905 |
T |
|
| Q |
101 |
gtgacagctgggaggtttctagggagaaccttttgcttacagggaaacacaaatccagagtgggaccaggtctttgcacttgagaatgatcaaattgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42451906 |
gtgacagctgggaggtttctagggagaaccttttgcttacagggaaacacaaatccagagtgggaccaggtctttgcacttgagaatgatcaaattgaaa |
42452005 |
T |
|
| Q |
201 |
aggaagggataaaaactgttgagatttttgtgaagaataat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42452006 |
aggaagggataaaaactgttgagatttttgtgaaggataat |
42452046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University