View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921_high_9 (Length: 610)
Name: NF5921_high_9
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 13 - 293
Target Start/End: Original strand, 31936235 - 31936515
Alignment:
| Q |
13 |
aaaatacggtgatgtgttcaatgtgtctggtgagttatcatcacaacccattgcaccaagagatgctgctaccatgcaatctgcagaatacagaacattt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31936235 |
aaaatacggtgatgtgttcaatgtgtctggtgagttatcatcacaacccattgcaccaagagatgctgctaccatgcaatctgcagaatatagaacattt |
31936334 |
T |
|
| Q |
113 |
ggccagactagaaaagatgggccagcttctctcatgacttctgctgcccnnnnnnntgaggatgctggtttcatcaaacataacactgctacaaacattg |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31936335 |
ggccagactagaaaagatgggcctgcttctctcatgacttctgctgcccaaaaaaatgaggatgctggtttcatcaaacataacactgctacaaacattg |
31936434 |
T |
|
| Q |
213 |
caagaaatgaaggtgttgctgtttcagaaacttatgatgggggcaaacgtgtcatcactgagactcttggtggacaggcaa |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31936435 |
caagaaatgaaggtgttgctgtttcagaaacttatgatgggggcaaacgtgtcatcactgagactcttggtggacaggcaa |
31936515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 132; E-Value: 3e-68
Query Start/End: Original strand, 13 - 293
Target Start/End: Original strand, 31933261 - 31933541
Alignment:
| Q |
13 |
aaaatacggtgatgtgttcaatgtgtctggtgagttatcatcacaacccattgcaccaagagatgctgctaccatgcaatctgcagaatacagaacattt |
112 |
Q |
| |
|
||||||||||||| | ||||| ||||||||||| ||||||||||| || |||||||||||||||||||| ||||||||||| |||||| | |||||||| |
|
|
| T |
31933261 |
aaaatacggtgatatattcaacgtgtctggtgatttatcatcacagcctattgcaccaagagatgctgcaaccatgcaatcagcagaagatagaacattg |
31933360 |
T |
|
| Q |
113 |
ggccagactagaaaagatgggccagcttctctcatgacttctgctgcccnnnnnnntgaggatgctggtttcatcaaacataacactgctacaaacattg |
212 |
Q |
| |
|
| ||| || ||||||||||||| ||||| ||||||||||||||||| | |||||||||||||||||| | |||||||||| ||||| || | |
|
|
| T |
31933361 |
gaccatgctcgaaaagatgggcctgcttcactcatgacttctgctgctcaaaagaatgaggatgctggtttcattgataataacactgcaacaaatatag |
31933460 |
T |
|
| Q |
213 |
caagaaatgaaggtgttgctgtttcagaaacttatgatgggggcaaacgtgtcatcactgagactcttggtggacaggcaa |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||| | || |||| ||||||||||| ||||| ||||| |||||||||||||||| |
|
|
| T |
31933461 |
caagaaatgaaggtgttgctgtttcagaaattaataatggaggcaaacgtgttatcacagagacccttggtggacaggcaa |
31933541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University