View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921_low_46 (Length: 357)
Name: NF5921_low_46
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921_low_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 16 - 341
Target Start/End: Original strand, 43778938 - 43779263
Alignment:
| Q |
16 |
atatcagccagattgtcacaattgcaatagcaacttctgcgtagttatatttttattttgaatttcatttttaaatcgaccagcaatataaatttgcttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43778938 |
atatcagccagattgtcacaattgcaatagcaacttctgcgtagttatatttttattttgaagttcttttttaaatcgaccagcaatataaatttgcttg |
43779037 |
T |
|
| Q |
116 |
gccctttgataaatgactagatcagatgctatgtatatagtattatagatgatcacatgtgagtttcattggctaatggctattatatagatccataata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43779038 |
tccctttgataaatgactagatcagatgctacgtatatagtattatagatgatcacatgtgagtttcattggctaatggctattatatagatccataata |
43779137 |
T |
|
| Q |
216 |
ttaggagtagttatctcaattgtttgaattaaaatgttgtggctccaattgggtatgggaattacagcttgtgtattattacggttgaggtaattttaga |
315 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43779138 |
tttggagtagttatctcaattgtttgaattaaaatgttgtggctccaattgggtatgggaattacagcttgtgtattattacggttgaggtaattttaga |
43779237 |
T |
|
| Q |
316 |
atatatgaaaatataatgtaatcact |
341 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
43779238 |
atatatgaaaatataatgtaatcact |
43779263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University