View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921_low_62 (Length: 274)
Name: NF5921_low_62
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921_low_62 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 42600580 - 42600322
Alignment:
| Q |
1 |
caactccttcaactttccacgttccaatcccaaaccttcagaaagcaactcaaaaaccacttcagcaactccggccgcatgaaaatcccattcaaccatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42600580 |
caactccttcaactttccacgttccaatcccaaaccttcagagagcaactcaaaaaccacttcagcaactccggccgcatgaaaatcccattcaaccatc |
42600481 |
T |
 |
| Q |
101 |
tccttacgacaaatctccggcaactcctcggctttcggtgcctccggtgccatccacgcttgcagagaatcatgccagctggcagcgttggttctataca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42600480 |
tccttacgacaaatctccggcaactcctcggctttcggtgcctccggtgccatccacgcttgcagagaatcatgccagctggcagcgttggttctataca |
42600381 |
T |
 |
| Q |
201 |
agtcattgttgcttgcatacatcactccacgtccttcatctcgtttgtagtatttggat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42600380 |
agtcattgttgcttgcatacatcactccacgtccttcatctcgtttgtagtatttggat |
42600322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University