View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921_low_70 (Length: 260)
Name: NF5921_low_70
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921_low_70 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 10 - 136
Target Start/End: Complemental strand, 506747 - 506621
Alignment:
| Q |
10 |
attatactttggttcaagtttagacacatttatgagttagattgtccttttctttcaactttcggctgcactttccatttaaacgaacccatgtgtcatt |
109 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
506747 |
attatactttggttcaagcttagacacatttatgagttagattgtccttttctttcaactttcggctgcactttccatttaaacgaacccatgtgtcatt |
506648 |
T |
 |
| Q |
110 |
ctcaaaaagagaccaatagatcttttt |
136 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
506647 |
ctcaaaaagagaccaatagatcttttt |
506621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 198 - 260
Target Start/End: Complemental strand, 506617 - 506555
Alignment:
| Q |
198 |
aaacagcaaaatttattacgcataacctgcttaggaagcgcaaaggccaataaaaacaacaat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
506617 |
aaacagcaaaatttattacgcataacctgcttaggaagcgcaaaggccaataaaaacaacaat |
506555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 202 - 258
Target Start/End: Complemental strand, 5179765 - 5179709
Alignment:
| Q |
202 |
agcaaaatttattacgcataacctgcttaggaagcgcaaaggccaataaaaacaaca |
258 |
Q |
| |
|
||||||||| ||||| |||||||| | ||||||||||||||||| |||||||||| |
|
|
| T |
5179765 |
agcaaaattcattacacataaccttcaaaggaagcgcaaaggccagcaaaaacaaca |
5179709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University