View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921_low_79 (Length: 245)
Name: NF5921_low_79
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921_low_79 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 23017838 - 23017609
Alignment:
| Q |
1 |
gttgaattttgatctttattgttaaagttgaatgtcgatttgataaaatgaccacaaggtattaacattgacaaaaaattcagtgttgttaattgttaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23017838 |
gttgaattttgatctttattgttaaagttgaatgtccatttgataaaatgaccacaaggtattaacattgacaaaaatttcagtgttgttaattgttaaa |
23017739 |
T |
|
| Q |
101 |
ttacgtaaagaaattgtttaccacttttcagagatgtctgagaaattctctccagcgcttcgaattggagatgtcaatgatttcattgtgccttcacaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23017738 |
ttacgtaaagaaattgtttaccacttttcagagatgtctgagaaattctctccagcgcttcgaattggagatgtcaatgatttcattgtgccttcacaag |
23017639 |
T |
|
| Q |
201 |
catgcacagtctccctcaaggaaagaaggt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23017638 |
catgcacagtctccctcaaggaaagaaggt |
23017609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 129 - 221
Target Start/End: Original strand, 54912753 - 54912845
Alignment:
| Q |
129 |
cagagatgtctgagaaattctctccagcgcttcgaattggagatgtcaatgatttcattgtgccttcacaagcatgcacagtctccctcaagg |
221 |
Q |
| |
|
|||||||||||||||||||||| || || ||||||||||||||| |||| |||||||||| |||||||| ||||| | |||||||||||||| |
|
|
| T |
54912753 |
cagagatgtctgagaaattctcacctgctcttcgaattggagatctcaacgatttcattgcaccttcacaggcatgtatagtctccctcaagg |
54912845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University