View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921_low_87 (Length: 234)
Name: NF5921_low_87
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921_low_87 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 32218726 - 32218579
Alignment:
| Q |
1 |
tttagccatattataaggataatgtctaatcgtagggtccttgagattaatgtagacgtggaagttgttgtccgtgactattaccgggccaaactaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32218726 |
tttagccatattataaggataatgtctaatcgtagggtccttgagattaatgtagacgtggaagttgttgtccgtgactattaccgggccaaactaaatt |
32218627 |
T |
 |
| Q |
101 |
atcttttggctttgacttattaatgattgtctctataaagtgatgcta |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32218626 |
atcttttggctttgacttattaatgattgtctctataaagtgatgcta |
32218579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 168 - 221
Target Start/End: Complemental strand, 32218590 - 32218537
Alignment:
| Q |
168 |
aaagtgatgctattttagatctcttttcttcattgtggggtatatcatgtccct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32218590 |
aaagtgatgctattttagatctcttttcttcattgtggggtatatcatgtccct |
32218537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University