View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921_low_88 (Length: 226)
Name: NF5921_low_88
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921_low_88 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 77 - 212
Target Start/End: Original strand, 54106975 - 54107110
Alignment:
| Q |
77 |
tcaatttattttgaatttagtttggtgatgaaatttgacatgcacctaattagtacgagcaatcttgaattttgttttatatccttgtcttggagtgttc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54106975 |
tcaatttattttgaatttagtttggtgatgaaatttgacatgcacctatttagtacgagcaatcttgaattttgttttatatccttgtcttggagtgttc |
54107074 |
T |
 |
| Q |
177 |
ataaaccgcagaagaagcatcatggaaggttcaaag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
54107075 |
ataaaccgcagaagaagcatcatggaaggttcaaag |
54107110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University