View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921_low_92 (Length: 206)
Name: NF5921_low_92
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921_low_92 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 48 - 192
Target Start/End: Complemental strand, 22721879 - 22721735
Alignment:
| Q |
48 |
atctaaggaccaattaattctagtggaccaatcccaccgctcacttgcaggggttctatttaaagccattacaaaattttgtatgaacttgcccatcaaa |
147 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |||||||||| |||||| ||||||||||| |||||| || |
|
|
| T |
22721879 |
atctaaggaccaattaattcgagtggaccaatcccaccgctcacttgcaggggctctgtttaaagccagaacaaaactttgtatgaacctgcccaatgaa |
22721780 |
T |
|
| Q |
148 |
attgatattggagaatcgaacatgagatcttgagaggagcatact |
192 |
Q |
| |
|
|||| ||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
22721779 |
attggtattgaagaatcgaacttgagatcttgagaggagcatact |
22721735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 49
Target Start/End: Complemental strand, 22721970 - 22721933
Alignment:
| Q |
12 |
ttattctcatcattctcatatataaaaatcattctcat |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22721970 |
ttattctcatcattctcatatataaaaatcattctcat |
22721933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 139 - 182
Target Start/End: Complemental strand, 16831656 - 16831613
Alignment:
| Q |
139 |
cccatcaaaattgatattggagaatcgaacatgagatcttgaga |
182 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
16831656 |
cccatcaaaattgacacaggagaatcgaacatgagatcttgaga |
16831613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 161
Target Start/End: Complemental strand, 10059210 - 10059124
Alignment:
| Q |
75 |
ccaatcccaccgctcacttgcaggggttctatttaaagccattacaaaattttgtatgaacttgcccatcaaaattgatattggaga |
161 |
Q |
| |
|
||||| |||||| |||||||||| | || |||||||||| |||||| | |||||||||||||||||| ||||||| ||| |||| |
|
|
| T |
10059210 |
ccaattccaccgtccacttgcaggagctccgtttaaagccaaaacaaaactctgtatgaacttgcccatcgaaattgacattagaga |
10059124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 103 - 152
Target Start/End: Complemental strand, 35797589 - 35797540
Alignment:
| Q |
103 |
ctatttaaagccattacaaaattttgtatgaacttgcccatcaaaattga |
152 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||| |
|
|
| T |
35797589 |
ctatttaaagccaaaccaaagttttgtatgaacttgcccaccaaaattga |
35797540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University