View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5922-Insertion-4 (Length: 203)
Name: NF5922-Insertion-4
Description: NF5922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5922-Insertion-4 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 9 - 203
Target Start/End: Complemental strand, 8443489 - 8443297
Alignment:
| Q |
9 |
ctttctaatcatttatcgacaagtattttgaggaaggaactatggaaaaaagagagaaaacgtaagttgagcaaaaacagtgcgatcaaccaacgtgtaa |
108 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8443489 |
ctttctaatcatttctcgacaagtattttgaggaaggaactatggaaaaa-gagagaaaacgtaagttgagcaaaaacagtgcgatcaaccaacgtgtaa |
8443391 |
T |
 |
| Q |
109 |
gtcacgaattggtgaatttgttattcaactttacgtagaagataaacaaagaaaagacnnnnnnntaactccaaaacattcctcctaagggcatg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8443390 |
gtcacgaattggtgaatttgttattcaactttacgtagaagataaacaaagaaaagacaaaaaaa-aactccaaaacattcctcctaagggcatg |
8443297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University