View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5922_low_8 (Length: 223)
Name: NF5922_low_8
Description: NF5922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5922_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 75 - 208
Target Start/End: Complemental strand, 3879352 - 3879218
Alignment:
| Q |
75 |
agggattggaataaaagtggattcacttcatgtactttaaaaagtcgcacattagac-nnnnnnntgatatgatatttgaagatatctcttaccttatta |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||| |||||||| ||||||| | |
|
|
| T |
3879352 |
agggattggaataaaagtggattcacttcatgtactttaaaaagttgcacattagacaaaaaaaatgatatgatatgtgaacatatctctcaccttataa |
3879253 |
T |
|
| Q |
174 |
gctgattttgtaatgatgagttatgccctaatttc |
208 |
Q |
| |
|
| || |||||||| ||||| ||||||||||||||| |
|
|
| T |
3879252 |
gttggttttgtaaagatgaattatgccctaatttc |
3879218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 16 - 64
Target Start/End: Complemental strand, 3879437 - 3879389
Alignment:
| Q |
16 |
aatatcaagcctcacaccttactcaccgcatcatcttcttcaatgttgg |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3879437 |
aatatcaagcctcacaccttactcaccgcatcatcttcttcaatgttgg |
3879389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University