View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5923-Insertion-4 (Length: 428)
Name: NF5923-Insertion-4
Description: NF5923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5923-Insertion-4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 153 - 366
Target Start/End: Complemental strand, 44404305 - 44404092
Alignment:
| Q |
153 |
ctggaactttggttttaatgtttatttcgtaggaagaaagagtattttgaggaaaagaagtttccaaatatataaagtggaaggaagggcggcgaaaaag |
252 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44404305 |
ctggaattttggttttaatgtttatttcttaggaagaaagagtattttgaggaaaagaagtttccaaatatataaagtggaaggaagggcggcgaaaaag |
44404206 |
T |
|
| Q |
253 |
acaatcgaaggaacggtggaaaagtatatgtgaaaggtgggacctgagagcgtgcggcggctttgtgggagggagaccaggtcgtgaatcacaagtcatg |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44404205 |
acaatcgaaggaacggtggaaaagtatatgtgaaaggtgggacctgggagcgtggggtggctttgtgggagggagaccaggtcgtgaatcacaagtcatg |
44404106 |
T |
|
| Q |
353 |
gtggagtcaattaa |
366 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44404105 |
gtggagtcaattaa |
44404092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 13 - 72
Target Start/End: Complemental strand, 44404426 - 44404367
Alignment:
| Q |
13 |
gattataactaaatcatcattaatatgtaacctatgttttgttgccacgtggtagtagaa |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44404426 |
gattataactaaatcatcattaatatgtaacctatgttttgttgccacgtggtagtagaa |
44404367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 360 - 406
Target Start/End: Complemental strand, 44404067 - 44404021
Alignment:
| Q |
360 |
caattaacaagtgagtgagctgaatctagacttgctttttgacttgg |
406 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44404067 |
caattaacaagtgagtgagctgaatctggacttgctttttgacttgg |
44404021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University