View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5923_high_12 (Length: 294)
Name: NF5923_high_12
Description: NF5923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5923_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 9 - 277
Target Start/End: Complemental strand, 25658221 - 25657953
Alignment:
| Q |
9 |
gaagaatattataaatgattaaataagtttttagtatctttaaaatttcataattttatttttggttcctatgnnnnnnnttgtattttatagtctatca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
25658221 |
gaagaatattataaatgattaaataagtttttaatatctctaaaatttcaaaattttatttttggttcctatgaaaaaaattgtattttgtagtctatca |
25658122 |
T |
|
| Q |
109 |
aaatatctctatcaccatctatgtatttagtcctaaaattaatagcttgttaactacagaaattttagcgatattatcatatgagttaggatcatctcca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| ||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
25658121 |
aaatatctctatcaccatctatgtatttagtcctaaaattaatagcctgttaactacaaaaaattttgtgatattatcatatgagttaggatcatctcca |
25658022 |
T |
|
| Q |
209 |
tttgacaataactcagtttttcctttctccttccacatccaaacgcaactgatgtgatgtaattgttca |
277 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25658021 |
tttgacaacaactcagtttttcctttctccttccacatccaaacgcaactgatgcgatgtaattgttca |
25657953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University