View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5923_high_5 (Length: 366)
Name: NF5923_high_5
Description: NF5923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5923_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 8e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 17 - 207
Target Start/End: Original strand, 3482652 - 3482843
Alignment:
| Q |
17 |
ttttcgactctatttacttgtgatctttaccaccaaactgatctctatcaccattaaaattgcattattcttgtatgatgattgtttaatagatctctta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3482652 |
ttttcgactctatttacttgtgatctttaccaccaaactgatctctaccaccattaaaattgcattattcttgtatgatgattgtttaatagacctctta |
3482751 |
T |
 |
| Q |
117 |
atttgctcaatcgatcgaatcgtaacttttgatcggctttttcataaatgtcaccaattatga-ggggtctattgaacaatcatgttcttct |
207 |
Q |
| |
|
||||||||||||||| ||||||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3482752 |
atttgctcaatcgatgagatcgtaatttttaatcggctttttcataaatgtcaccaattatgagggggtctattgaacaatcatgttcttct |
3482843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 242 - 358
Target Start/End: Original strand, 3482847 - 3482964
Alignment:
| Q |
242 |
gaacctttcccggaaagaaaatcagtccaataaagcccaattggataagtggggctctttagcccccatttttgcggg-nnnnnnncctatttgatcgaa |
340 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3482847 |
gaacctttccctgaaagaaaatcagtccaataaagcccaattggataagtggggctctttagcccccatttttgcgggaaaaaaaccctatttgatcgaa |
3482946 |
T |
 |
| Q |
341 |
atgtatcttatgatgatg |
358 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3482947 |
atgtatcttatgatgatg |
3482964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University