View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5924-Insertion-9 (Length: 258)
Name: NF5924-Insertion-9
Description: NF5924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5924-Insertion-9 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 165 - 258
Target Start/End: Complemental strand, 40144415 - 40144322
Alignment:
| Q |
165 |
gataaagttgagcatttatgaaacaggttatgtggaatggagtttcttgaacactcccacctacttgtatttcctttttccactcaccccggac |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40144415 |
gataaagttgagcatttatgaaacaggttatgtggaatggagtttcttgaacactcccacctacttgtatttcctttttccactcaccccggac |
40144322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 9 - 101
Target Start/End: Complemental strand, 40144551 - 40144459
Alignment:
| Q |
9 |
atgatgatgttgtttttggttagaactcatattgtggtgacaaagcaaagcacactatagttgcatttgtttgtttaggaaccttatgagttg |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40144551 |
atgatgatgttgtttttggttagaactcatattgtggtgacaaagcaaagcacactatagttgcatttgtttgtttaggaaccttatgagttg |
40144459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University