View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5925_high_3 (Length: 362)
Name: NF5925_high_3
Description: NF5925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5925_high_3 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
| [»] chr2 (2 HSPs) |
| |
|
| [»] scaffold0008 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 219 - 362
Target Start/End: Original strand, 18098805 - 18098948
Alignment:
| Q |
219 |
ggtgtatgtgtcatttacacaaggaaggggatgtgtatgtacaannnnnnnaacaaataaaagtaagtgaggatatttcaattaacacaaaatgcattga |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18098805 |
ggtgtatgtgtcatttacacaaggaaggggatgtgtatgtacaatttttttagcaaataaaagtaagtgaggatatttcaattaacacaaaatgcattga |
18098904 |
T |
|
| Q |
319 |
agtatggtgaggatatttcaatttctatgtaatttcaatatggt |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18098905 |
agtatggtgaggatatttcaatttctatgtaatttcattatggt |
18098948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 16 - 162
Target Start/End: Original strand, 18098589 - 18098735
Alignment:
| Q |
16 |
atgccttgggaaacttgttggtgttgtttctacttggaggtgtttttgcaggggtgacactagactggctgtggttgataggcaaaggttggtgatatct |
115 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18098589 |
atgctttgggaaacctgttggtgttgtttctacttggaggtatttttgcaggggtgacactagactggctgtggttgataggcaaaggttggtgagatct |
18098688 |
T |
|
| Q |
116 |
caattagcacaagctaaaggagtagttgtgattgagactatcattgt |
162 |
Q |
| |
|
|||||||||||| |||| ||| ||||| | |||||| |||||||||| |
|
|
| T |
18098689 |
caattagcacaaactaagggaatagttttaattgaggctatcattgt |
18098735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 219 - 362
Target Start/End: Original strand, 37856412 - 37856555
Alignment:
| Q |
219 |
ggtgtatgtgtcatttacacaaggaaggggatgtgtatgtacaannnnnnnaacaaataaaagtaagtgaggatatttcaattaacacaaaatgcattga |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37856412 |
ggtgtatgtgtcatttacacaaggaaggggatgtgtatgtacaatttttttagcaaataaaagtaagtgaggatatttcaattaacacaaaatgcattga |
37856511 |
T |
|
| Q |
319 |
agtatggtgaggatatttcaatttctatgtaatttcaatatggt |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37856512 |
agtatggtgaggatatttcaatttctatgtaatttcattatggt |
37856555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 16 - 162
Target Start/End: Original strand, 37856196 - 37856342
Alignment:
| Q |
16 |
atgccttgggaaacttgttggtgttgtttctacttggaggtgtttttgcaggggtgacactagactggctgtggttgataggcaaaggttggtgatatct |
115 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37856196 |
atgctttgggaaacctgttggtgttgtttctacttggaggtatttttgcaggggtgacactagactggctgtggttgataggcaaaggttggtgagatct |
37856295 |
T |
|
| Q |
116 |
caattagcacaagctaaaggagtagttgtgattgagactatcattgt |
162 |
Q |
| |
|
|||||||||||| |||| ||| ||||| | |||||| |||||||||| |
|
|
| T |
37856296 |
caattagcacaaactaagggaatagttttaattgaggctatcattgt |
37856342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 16 - 110
Target Start/End: Complemental strand, 62093 - 61999
Alignment:
| Q |
16 |
atgccttgggaaacttgttggtgttgtttctacttggaggtgtttttgcaggggtgacactagactggctgtggttgataggcaaaggttggtga |
110 |
Q |
| |
|
|||| |||||||| | |||||||||||||| || |||||| ||||||||||||| ||||| || ||| | ||||| ||||| ||||| |||||| |
|
|
| T |
62093 |
atgcgttgggaaatatcttggtgttgtttcttctaggaggtatttttgcaggggtaacacttgattggttatggttaataggtaaaggatggtga |
61999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University