View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5926_high_3 (Length: 251)
Name: NF5926_high_3
Description: NF5926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5926_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 29555449 - 29555667
Alignment:
| Q |
1 |
ccctcaagaaggacaattgcattgttaaaattaattcctgtttagcttattgtacaattgtagcagcttttaaccaacttttccgcaattggatgtttct |
100 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| || ||||| ||||||| ||||||| |
|
|
| T |
29555449 |
ccctcaggaaggacagttgcattgttaaaattaattgatgtttagcttattgtacaattttagcagcttttaacctacatttccacaattgggtgtttct |
29555548 |
T |
 |
| Q |
101 |
tatttatgatatatatggttcaatgacaagtcaaattatgattaaggagaaccatagtcc-atacacatgcaatttgatgagattattaattttcacatt |
199 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
29555549 |
tattgatgatatatatggttcaatgataagtcaaattatgattaaggagaaccatagtcctttacatatgcaatttgatgagattattaatttcgacatt |
29555648 |
T |
 |
| Q |
200 |
atcataaaaatatttttgt |
218 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
29555649 |
atcataaaaatatttttgt |
29555667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University