View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5926_low_5 (Length: 244)
Name: NF5926_low_5
Description: NF5926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5926_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 52835888 - 52835664
Alignment:
| Q |
1 |
aagtggcgaggattcttttattggcataattgaacagtttcaactttcaagtgtgctcaaaagctaataattgtcctcttctttataaataaatagttga |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52835888 |
aagtggcgagtattcttttattggcataattgaacagtttcaactttcaagtgtgctcaaaagctaataattgtcctcttctttataaataaatagttga |
52835789 |
T |
|
| Q |
101 |
ttcccnnnnnnnna-aacagaattaaacagtatcgatacaaatagcagtatattgaagtttctctcatatattctctattttcattctttctgatttcta |
199 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52835788 |
ttcccttttttttttaacagaattaaacagtatcaatacaaatagcagtatattgaagtttctctcatatattctctattttcattctttctgatttcta |
52835689 |
T |
|
| Q |
200 |
acaaacttaaactgattggccagat |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
52835688 |
acaaacttaaactgattggccagat |
52835664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University