View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5927_low_2 (Length: 289)
Name: NF5927_low_2
Description: NF5927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5927_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 194 - 276
Target Start/End: Original strand, 51164183 - 51164265
Alignment:
| Q |
194 |
tgaatgtgaatggtacttatttctttatctttatttcaagtcatctttttctttcnnnnnnntctcaactcatcttttggctt |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
51164183 |
tgaatgtgaatggtacttatttctttatctttatctcaagtcatctttttctttcaaaaaaatctcaagtcatcttttggctt |
51164265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 20 - 71
Target Start/End: Original strand, 51164009 - 51164060
Alignment:
| Q |
20 |
agcactttggagctggcaggtagtacactgaaacagttaattaaatattacc |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51164009 |
agcactttggagctggcaggtagtacactgaaacagttaattaaatattacc |
51164060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University