View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5927_low_2 (Length: 289)

Name: NF5927_low_2
Description: NF5927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5927_low_2
NF5927_low_2
[»] chr3 (2 HSPs)
chr3 (194-276)||(51164183-51164265)
chr3 (20-71)||(51164009-51164060)


Alignment Details
Target: chr3 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 194 - 276
Target Start/End: Original strand, 51164183 - 51164265
Alignment:
194 tgaatgtgaatggtacttatttctttatctttatttcaagtcatctttttctttcnnnnnnntctcaactcatcttttggctt 276  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||       |||||| ||||||||||||||    
51164183 tgaatgtgaatggtacttatttctttatctttatctcaagtcatctttttctttcaaaaaaatctcaagtcatcttttggctt 51164265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 20 - 71
Target Start/End: Original strand, 51164009 - 51164060
Alignment:
20 agcactttggagctggcaggtagtacactgaaacagttaattaaatattacc 71  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
51164009 agcactttggagctggcaggtagtacactgaaacagttaattaaatattacc 51164060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University