View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5928_high_5 (Length: 207)
Name: NF5928_high_5
Description: NF5928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5928_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 46080311 - 46080475
Alignment:
| Q |
19 |
atatatacgaaaagataagatatgatgatacaacaacagtacttcaaaaataaaatcttgagtcaacaacattgttaaatcattgtacgaaagaaagaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46080311 |
atatatacgaaaagataagatatgatgatacaacaacagtacttcaaaattaaaatcttgagtcaacaacattgttaaatcattgtac----gaaagaat |
46080406 |
T |
 |
| Q |
119 |
ttcccacagaccaaacaaagtagttatatcaagaattgtaatctatcaagagttcgtgtttagttcgat |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46080407 |
ttcccacagaccaaacaaagtagttatatcaagaattgtaatctattaagagttcgtgtttagttcgat |
46080475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University