View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5929_low_4 (Length: 248)
Name: NF5929_low_4
Description: NF5929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5929_low_4 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 6453345 - 6453574
Alignment:
| Q |
19 |
cagttggttaagcaacgggttcaacttaggaagtaaggtcaatgttcaatcctcgtagaatacactcttgaacaaggggcaaaaagttttgagttgctac |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6453345 |
cagttcgttaagcaacgggttcaacttaggaagtaaggtcaatgttcaatcctcgtagaatacactcttgaacaaggggcaaaaagttttgagttgctac |
6453444 |
T |
 |
| Q |
119 |
ctaaacacttgggcagatattagcttcataggcagttcaaaagatcgaaattcgtagtgatactttgtaaaaccacgaagtctcaaagttctttgtatat |
218 |
Q |
| |
|
|||| |||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
6453445 |
ctaagcacttgggcagatattagcttcatagcctgttcaaaagatcgaaattcgtagtgatactttgtaaaaccaccgagtctcaaagttcttcgtatat |
6453544 |
T |
 |
| Q |
219 |
gtttgaatttgtggtaaatttgtcaaaatc |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |
|
|
| T |
6453545 |
gtttgaatttgtggttaatttgtcaaaatc |
6453574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University