View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5930-Insertion-7 (Length: 240)
Name: NF5930-Insertion-7
Description: NF5930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5930-Insertion-7 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 9 - 240
Target Start/End: Complemental strand, 47729514 - 47729282
Alignment:
| Q |
9 |
gggagacattcaaaggtaccactatttatcttccttttttgcataattggtgttgtgtaaaataaacttcatctaaatgctnnnnnnnnnnnn--cctta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
47729514 |
gggagacattcaaaggtaccactatttatcttcattttttgcataattggtgt-gtgtaaaataaacttcatctaaatgctaaaaaaaaaatatacctta |
47729416 |
T |
|
| Q |
107 |
atttccttcttattttcatgattttgtaggattccgcgcacttgatttcaatgtggtttcttccttcatatttgcaattattcttcatgcagctatgagt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47729415 |
atttccttcttattttcatgattttgtaggattccgcgcacttggtttcaatgttgtttcttccttcatatttgcaattattcttcatgcagctatgagt |
47729316 |
T |
|
| Q |
207 |
tattcaactcttcctgtgagacatagctaccttc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47729315 |
tattcaactcttcctgtgagacatagctaccttc |
47729282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University