View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5930_high_12 (Length: 308)
Name: NF5930_high_12
Description: NF5930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5930_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 17 - 298
Target Start/End: Complemental strand, 33308028 - 33307747
Alignment:
| Q |
17 |
atttgcaatgaattggcagatttgtataagattatttgcaaaacaagttgataaatgcctaaataatatagtgacaattaggtaaatttgataactataa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33308028 |
atttgcaatgaattggcagatttgtataagattatttgcaaaacaagttgataaatgcctaaataatatagtgacaattaggtaaatttgataactataa |
33307929 |
T |
|
| Q |
117 |
attatttccaaataagagaaaatcatcaattactataagatttagaagatttcaccataagcaacttttggagttccttgaaatgtttacgttgaaaatg |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33307928 |
attatttccaaataagagaaaatcaacaattactataagatttagaagatttcaccataagcaacttttggagttccttgaaatgtttacgttgaaaatg |
33307829 |
T |
|
| Q |
217 |
aaatagctaattaagataaactagaacgacagcgtgcttgatagacatggttgataatataatatattaacattgtttcttc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33307828 |
aaatagctaattaagataaactagaacgacggcgtgcttgatagacatggttgataatataatatattaacattgtttcttc |
33307747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University