View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5930_high_13 (Length: 268)
Name: NF5930_high_13
Description: NF5930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5930_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 31 - 249
Target Start/End: Original strand, 16242690 - 16242908
Alignment:
| Q |
31 |
ctcactctcaccgttttcattgtggcatttgctctgctcacaatcactctcgtcgtttctgtttcacaatatctctctgaataatatgtgacttgaactc |
130 |
Q |
| |
|
||||| |||| | |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16242690 |
ctcaccctcatcattttcattgtggcatttgctctgctcacaatctctctcgtcgtttctgtctcacaatatctctctgaataatatgtgacttgaactc |
16242789 |
T |
 |
| Q |
131 |
ccgtgacatcgacgacgactgtggttaggttgacgatggcattggtgagatttgagggtgatgacgacgaatgatgatgatgatgagacatgcagtaagg |
230 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16242790 |
ccgtgacatcgacgacgactatggttaggttgacgatggcagtggtgagatttgagggtgacgacgacgaatgatgatgatgatgagacatgcattaagg |
16242889 |
T |
 |
| Q |
231 |
accacggtgatgacattat |
249 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
16242890 |
accacggcgatgacattat |
16242908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University