View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5930_high_19 (Length: 204)
Name: NF5930_high_19
Description: NF5930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5930_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 184
Target Start/End: Original strand, 968728 - 968894
Alignment:
| Q |
18 |
atttcttatcttcctataacttacattattattgatatagtaaatatttttgaggaaaaccaaatgttgctgaagtgtacagacaaatatggtatccgaa |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
968728 |
atttcttatcttcctataacttatattattattgatatagtaaatatttttgaggaaaaccaagtgttgctgaagtgtacaggcaaatatggtacccgaa |
968827 |
T |
 |
| Q |
118 |
aatggattatttacaattcaataaatggtacttttgcgtgtactcggttggaaaattccctagaagt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
968828 |
aatggattatttacaattcaataaatggtacttttgcgtgtactcggttagaaaatgccctagaagt |
968894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University