View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5930_low_10 (Length: 318)
Name: NF5930_low_10
Description: NF5930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5930_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 9 - 303
Target Start/End: Original strand, 14870133 - 14870427
Alignment:
| Q |
9 |
agcaaaggaatggagaaactggaatgagtttggggatgatgtggttaagagggatcagataggaaaggcaataggtttattgatgggaggtggagaagag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14870133 |
agcaaaggaatggagaaactggaatgagtttggggatgatgtggttaagagggatgagataggaaaggcaataggtttattgatgggaggtggagaagag |
14870232 |
T |
|
| Q |
109 |
tgtttagaaatgaggaagaaagctaaagcacttagtggtgctgcaaagaaagctatagaggttggtggttcttcatacactgggttgaaacaactaattg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14870233 |
tgtttagaaatgaggaagaaagctaaagcacttagtggtgctgcaaagaaagctatagaggttggtggttcttcatacactaagttgaaacaactaattg |
14870332 |
T |
|
| Q |
209 |
aggagcttaagtcattcaaacttgnnnnnnnggttaataacaaattggaggttgatttggtatcaacttagtaagcatcattctacattggaact |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14870333 |
aggagcttaagtcattcaaacttgaaaaaaaggttaataacaaattggaggttgatttggtatcaacttagtaagcatcattctacattggaact |
14870427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 9 - 232
Target Start/End: Complemental strand, 16908526 - 16908303
Alignment:
| Q |
9 |
agcaaaggaatggagaaactggaatgagtttggggatgatgtggttaagagggatcagataggaaaggcaataggtttattgatgggaggtggagaagag |
108 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||| |||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16908526 |
agcaaaagaatggagaaattggaatgagtttggggatgatgtggtgaagagggaggatataggaaaggcaataggtttattgatgggaggtggagaagag |
16908427 |
T |
|
| Q |
109 |
tgtttagaaatgaggaagaaagctaaagcacttagtggtgctgcaaagaaagctatagaggttggtggttcttcatacactgggttgaaacaactaattg |
208 |
Q |
| |
|
||||||||||||||||| | || ||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||| ||||||| ||||||||| |
|
|
| T |
16908426 |
tgtttagaaatgaggaaaagagttaaagcacttagtggtgctgcaaagaaagctattgaggttggtggttcttcttatactaagttgaaagaactaattg |
16908327 |
T |
|
| Q |
209 |
aggagcttaagtcattcaaacttg |
232 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
16908326 |
aggagcttaagtcatttaaacttg |
16908303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University