View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5931-Insertion-13 (Length: 48)

Name: NF5931-Insertion-13
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5931-Insertion-13
NF5931-Insertion-13
[»] chr5 (5 HSPs)
chr5 (9-48)||(38181325-38181364)
chr5 (9-48)||(38189767-38189806)
chr5 (9-48)||(38208549-38208588)
chr5 (9-48)||(38216992-38217031)
chr5 (9-48)||(38456686-38456725)


Alignment Details
Target: chr5 (Bit Score: 40; Significance: 0.00000000000001; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000001
Query Start/End: Original strand, 9 - 48
Target Start/End: Original strand, 38181325 - 38181364
Alignment:
Q  9 agctctaccctcaccatgttcataccttccacttccttca 48  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  38181325 agctctaccctcaccatgttcataccttccacttccttca 38181364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000001
Query Start/End: Original strand, 9 - 48
Target Start/End: Complemental strand, 38189806 - 38189767
Alignment:
Q  9 agctctaccctcaccatgttcataccttccacttccttca 48  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  38189806 agctctaccctcaccatgttcataccttccacttccttca 38189767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000001
Query Start/End: Original strand, 9 - 48
Target Start/End: Original strand, 38208549 - 38208588
Alignment:
Q  9 agctctaccctcaccatgttcataccttccacttccttca 48  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  38208549 agctctaccctcaccatgttcataccttccacttccttca 38208588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.00000000000001
Query Start/End: Original strand, 9 - 48
Target Start/End: Complemental strand, 38217031 - 38216992
Alignment:
Q  9 agctctaccctcaccatgttcataccttccacttccttca 48  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  38217031 agctctaccctcaccatgttcataccttccacttccttca 38216992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.00000000000001
Query Start/End: Original strand, 9 - 48
Target Start/End: Original strand, 38456686 - 38456725
Alignment:
Q  9 agctctaccctcaccatgttcataccttccacttccttca 48  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  38456686 agctctaccctcaccatgttcataccttccacttccttca 38456725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University