View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931-Insertion-6 (Length: 415)
Name: NF5931-Insertion-6
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931-Insertion-6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 393; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 393; E-Value: 0
Query Start/End: Original strand, 7 - 415
Target Start/End: Original strand, 46453753 - 46454161
Alignment:
| Q |
7 |
catattttgttcttttaccatcaaccttatgcaacagtcatatttgtatttatacagggatacacagcaagatctatttaatgccatgggatctatgtat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46453753 |
catattttgttcttttaccatcaaccttatgcaacactcatatttgtatttatacagggatacacagcaagatctatttaatgccatgggatctatgtat |
46453852 |
T |
|
| Q |
107 |
tcagcgatccttttcattggcatcacaaatggcacagctgttcaacctgttgtttcagtggaaagatctgtttcatatagagaaagagctgcagggatgt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46453853 |
tcagcgatccttttcattggcatcacaaatggcacagctgttcaacctgttgtttcagtggaaagatttgtttcatatagagaaagagctgcagggatgt |
46453952 |
T |
|
| Q |
207 |
actcggctttatgttttgcgtttgctcaggtattttttcagtttgtttcatatagagcaagagctcaggtatttttacttacaaagtgcctggaacctac |
306 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46453953 |
actcagctttatgttttgcatttgctcaggtattttttcagtttgtttcatatagagcaagagctcaggtatttttacttacaaagtgcctggaacctac |
46454052 |
T |
|
| Q |
307 |
agttttccataagttcactaatgcgttatcctccattgtgcaggttgtgattgagttcccttacgtgttcgcacaggctatcatatactcttcaatattc |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46454053 |
agttttccataagttcactaatgcgttatcctccattgtgcaggttgtgattgagttcccttacgtgttcgcacaggctatcatatactcttcaatattc |
46454152 |
T |
|
| Q |
407 |
tattccatg |
415 |
Q |
| |
|
||||||||| |
|
|
| T |
46454153 |
tattccatg |
46454161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University