View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_high_23 (Length: 442)
Name: NF5931_high_23
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 408; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 408; E-Value: 0
Query Start/End: Original strand, 16 - 431
Target Start/End: Original strand, 46453753 - 46454168
Alignment:
| Q |
16 |
catattttgttcttttaccatcaaccttatgcaacagtcatatttgtatttatacagggatacacagcaagatctatttaatgccatgggatctatgtat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46453753 |
catattttgttcttttaccatcaaccttatgcaacactcatatttgtatttatacagggatacacagcaagatctatttaatgccatgggatctatgtat |
46453852 |
T |
 |
| Q |
116 |
tcagcgatccttttcattggcatcacaaatggcacagctgttcaacctgttgtttcagtggaaagatttgtttcatatagagaaagagctgcagggatgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46453853 |
tcagcgatccttttcattggcatcacaaatggcacagctgttcaacctgttgtttcagtggaaagatttgtttcatatagagaaagagctgcagggatgt |
46453952 |
T |
 |
| Q |
216 |
actcggctttatgttttgcatttgctcaggtattttttcagtttgtttcatatagagcaagagctcaggtatttttacttacaaagtgcctggaacctac |
315 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46453953 |
actcagctttatgttttgcatttgctcaggtattttttcagtttgtttcatatagagcaagagctcaggtatttttacttacaaagtgcctggaacctac |
46454052 |
T |
 |
| Q |
316 |
agttttccataagttcactaatgcgttatcctccattgtgcaggttgtgattgagttcccttacgtgttcgcacaggctatcatatactcttcaatattc |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46454053 |
agttttccataagttcactaatgcgttatcctccattgtgcaggttgtgattgagttcccttacgtgttcgcacaggctatcatatactcttcaatattc |
46454152 |
T |
 |
| Q |
416 |
tattccatgggttcat |
431 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
46454153 |
tattccatgggttcat |
46454168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University