View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_high_53 (Length: 305)
Name: NF5931_high_53
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_high_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 5 - 289
Target Start/End: Complemental strand, 37320021 - 37319738
Alignment:
| Q |
5 |
ttgttgttccatatttgggcgaggtgcaatccatgcctgagtccagtttcccttcaaagcttatctgtacgtaccgtagcatggaatcgccctaaatatc |
104 |
Q |
| |
|
||||||||||||||| || | | || |||||||||||||| ||||| | ||||||||||||||| |||| | ||| |||||||||||| ||||||||||| |
|
|
| T |
37320021 |
ttgttgttccatattgggtcaatgttcaatccatgcctgaatccaggtacccttcaaagcttatatgtaaggaccatagcatggaatcaccctaaatatc |
37319922 |
T |
 |
| Q |
105 |
actggattaagaccccatggaaagatatagaccgtttaggacaaataaaatgtatatggccttttaatatgtttat--gtgtccctcgaggacaattgtc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37319921 |
actggattaagaccccatggaaagatatagaccgtttaggacaaataaaatg---atggccttttaatatgtttatatgtgtccctcgaggacaattgtc |
37319825 |
T |
 |
| Q |
203 |
aagttaacaattcaagggcaaaaccctaaacctcttctatcaccctaaaatcctaaatccattaactcatgacattggtccaagtat |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37319824 |
cagttaacaattcaagggcaaaaccctaaacctcttctatcaccctaaaatcctaaatccattaactcatgacattggtccaagtat |
37319738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University