View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_high_72 (Length: 252)
Name: NF5931_high_72
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_high_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 13 - 236
Target Start/End: Complemental strand, 742044 - 741821
Alignment:
| Q |
13 |
taatatttaccacaagatgggaatatcttgatctcatgaattacatcgttgtacttctatctatcaaagactataataagatttctacgtttaggaatga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
742044 |
taatatttaccacaagatgggaatatcttgatctcatgaattacatcgttgtacttctatctatcaaagactataataagatttctacgtttaggaatga |
741945 |
T |
 |
| Q |
113 |
gaatccatgggattgggattgaaaatgaacatatggagaatttcaaattgacaattttaaggcttgtcgaaatggttacagctttaaaggttttactaga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
741944 |
gaatccatgggattgggattgaaaatgaacatatggagaatttcaaattgacaattttaaggcttgtcgaaatggttagagttttaaaggttttactaga |
741845 |
T |
 |
| Q |
213 |
caacaacttttttcatgtttcttc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
741844 |
caacaacttttttcatgtttcttc |
741821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University