View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_high_76 (Length: 246)
Name: NF5931_high_76
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_high_76 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 10 - 246
Target Start/End: Original strand, 25538275 - 25538511
Alignment:
| Q |
10 |
tatcataaaccagacaccgcattttaagatcatcaaaaagctgattagccttatctaaatttccaagttgaagataagcagctataagattattgtaaac |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25538275 |
tatcataaaccagacactgcattttaagatcatcaaaaagctgattagccttatctaaatttccaagttgaagataagcagctataagattattgtaaac |
25538374 |
T |
 |
| Q |
110 |
aactgaattggcgtatgccatatctaacaagagctcatatgcttcgtcaatgcgaccagcgtcaatcaaagctttggttagaaaccgataggttacattt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25538375 |
aactgaattggcgtatgccatatctaacaagagctcatatgcttcgtcaatgcgaccagcgtcaatcaaagctttggttagaaaccgataggttacattt |
25538474 |
T |
 |
| Q |
210 |
gaaggtctcaaatgcgagtgagccttcatgctccgaa |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25538475 |
gaaggtctcaaatgcgagtgagccttcatgctccgaa |
25538511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 83
Target Start/End: Complemental strand, 43223737 - 43223687
Alignment:
| Q |
33 |
ttaagatcatcaaaaagctgattagccttatctaaatttccaagttgaaga |
83 |
Q |
| |
|
||||| ||||||||||||| |||||||||||| ||||| ||||||| |||| |
|
|
| T |
43223737 |
ttaagctcatcaaaaagctcattagccttatccaaattaccaagttcaaga |
43223687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University