View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_high_80 (Length: 240)
Name: NF5931_high_80
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_high_80 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 7 - 123
Target Start/End: Original strand, 44112327 - 44112443
Alignment:
| Q |
7 |
ccacttgattatgaagaacaacattgagcattatgttagaatatcactgcacttttttaaaactcttaacagattataattgaacaccgctatacttttt |
106 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44112327 |
ccacttgattataaagaacaacattgagcattatgttagaatatcactgcacttttttaaaactcttaacatattataattgaacaccgctatacttttt |
44112426 |
T |
|
| Q |
107 |
taaaaatgtcttttaaa |
123 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44112427 |
taaaaatgtcttttaaa |
44112443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 147 - 219
Target Start/End: Original strand, 44112872 - 44112944
Alignment:
| Q |
147 |
tatttaattgcaattttctctgcttacaatgacatgagactcctgaatagaaacacaactctattatgcgggg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44112872 |
tatttaattgcaattttctctgcttacaatgacatgagactcctgaatagaaacacaactctattatgcgggg |
44112944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 115 - 153
Target Start/End: Original strand, 44112638 - 44112676
Alignment:
| Q |
115 |
tcttttaaattttaattgaatgcactcctatctatttaa |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44112638 |
tcttttaaattttaattgaatgcactcctatttatttaa |
44112676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University