View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_high_83 (Length: 237)
Name: NF5931_high_83
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_high_83 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 83 - 218
Target Start/End: Complemental strand, 36686698 - 36686563
Alignment:
| Q |
83 |
tatgaaccaggttaagaagatgaagaaggaaatggtcacaatcacaaagattattaagtaaaattgaatcatcactatggtaagaaaatcaatgataaga |
182 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | | |||||||| |
|
|
| T |
36686698 |
tatgaacaaggttaagaagatgaagaaggaaatggtcacaatcacaaagattattaagtaaaattgaatcatcacaatggtaagaaagttattgataaga |
36686599 |
T |
 |
| Q |
183 |
ttcaaacatgttaaatgacttatagggcaagaaatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36686598 |
ttcaaacatgttaaatgacttatagggcaagaaatc |
36686563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University