View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_high_85 (Length: 233)
Name: NF5931_high_85
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_high_85 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 9 - 135
Target Start/End: Original strand, 4812047 - 4812174
Alignment:
| Q |
9 |
aatataactatctctggtggttctctttccatgtaatctgtctgcatgaaatcatatgttagtgaacaagaagaataagaagg-nnnnnnnnncaccatc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4812047 |
aatataactatctctggtggttctctttccatgtaatctgtctgcatgaaatcatatgttagtgaacaagaagaataagaaggaaaaaaaaaacaccatc |
4812146 |
T |
 |
| Q |
108 |
acaaaaatacgaactcaccaaaaacttg |
135 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
4812147 |
acaaaaatacgaactcaccaaaaacttg |
4812174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 168 - 233
Target Start/End: Original strand, 4812199 - 4812264
Alignment:
| Q |
168 |
ttctgtggatacaaacagcttttagagatatacattggtatgtctacgcaaggacaagtggagcaa |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4812199 |
ttctgtggatacaaacagcttttagagatatacattggtatgtctacgcaaggacaagtggagcaa |
4812264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 15 - 90
Target Start/End: Original strand, 4852713 - 4852788
Alignment:
| Q |
15 |
actatctctggtggttctctttccatgtaatctgtctgcatgaaatcatatgttagtgaacaagaagaataagaag |
90 |
Q |
| |
|
||||||| ||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4852713 |
actatctggggtagttctctttccatgtagtctgtctgcatgtaatcatatgttagtgaacaagaagaataagaag |
4852788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 171 - 226
Target Start/End: Original strand, 4852858 - 4852913
Alignment:
| Q |
171 |
tgtggatacaaacagcttttagagatatacattggtatgtctacgcaaggacaagt |
226 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4852858 |
tgtggaaacaaacagcttttagagatatacattggtatgtctacgcaaggacaagt |
4852913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University