View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_high_93 (Length: 216)
Name: NF5931_high_93
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_high_93 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 36 - 202
Target Start/End: Complemental strand, 20845004 - 20844838
Alignment:
| Q |
36 |
tatcaggaatgactttcgaatccttcgagtaacctaaatagaacgagacaatgttattttagcatcttacatagagtaggcctttatagagtacaatgtc |
135 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
20845004 |
tatcaggaatgactttcacatccttcgagtaacctaaatagaacgagacaatgttattttagcatcttgcatagagtaggcgtttatagagtacaatgtc |
20844905 |
T |
 |
| Q |
136 |
attgaagcaataattgtcgtaaggaaattgcctttctctctttcaaaattgctcaaacccaacaatt |
202 |
Q |
| |
|
|||||||||||| | ||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
20844904 |
attgaagcaatagtagtcgtaaggaaattgcccttctctctttcaaaattgctaaaacccaacaatt |
20844838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University