View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_low_40 (Length: 373)
Name: NF5931_low_40
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 94 - 367
Target Start/End: Complemental strand, 44548093 - 44547831
Alignment:
| Q |
94 |
tagatatttatcatttcaacatgtaaatataatctgcttatgaaaaataataatttaccttataattaatgttaatttggtcaaacgttaatattgaaag |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44548093 |
tagatatttatcatttcaacatgtaaatataatctccttatgaaaaa-----------cttacaattaatgttaatttggtcaaacgttaatattgaaag |
44548005 |
T |
 |
| Q |
194 |
agcaccctgtcacaacataaatcaaaaggcaaagtatacaaaccaaaatgatacagaaaaataacatgatgatttacaaagaataaagaatcaagtaaaa |
293 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44548004 |
agcaccctgtcacaacaaaaatcaaaaggcaaagtatacaaaccaaaatgatacacaaaaataagatgatgatttacaaagaataaagaatcaagtaaaa |
44547905 |
T |
 |
| Q |
294 |
catttctttgaccacttttagccttttattgtgcaagattatttacccttttatatgattgttgacttgcttag |
367 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44547904 |
catttctttgaccatttttagccttttattgtgcaagattatttaccctttttcatgattgttgacttgcttag |
44547831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 320 - 367
Target Start/End: Original strand, 2733238 - 2733285
Alignment:
| Q |
320 |
tattgtgcaagattatttacccttttatatgattgttgacttgcttag |
367 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2733238 |
tattgtgcaagattatttaccctttttcatgattgttgacttgcttag |
2733285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University