View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_low_52 (Length: 311)
Name: NF5931_low_52
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_low_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 22 - 295
Target Start/End: Complemental strand, 2276684 - 2276411
Alignment:
| Q |
22 |
gaatgattctagtacatacctttctacgcaaggtgagaagagaacgaccatgtgtgttcataagaacaagttcttccttatcacgtgtgtttggtccata |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2276684 |
gaatgattctagtacatacctttctacgcaaggtgagaagagaacgaccatgtgtgttcataagaacaagttcttccttatcacgtgtgtttggtccata |
2276585 |
T |
|
| Q |
122 |
cgagtcaaaccggaaaacgagttgtcccttacaatcatacacaacaaatccatcaccactgaaaaacctagatgttttcagaactgtaaggttggtttct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2276584 |
cgagtcaaaccggaaaacgagttgtcccttacaatcatacacaacaaacccatcaccactgaaaaacctagatgttttcagaactgtaaggttggtttct |
2276485 |
T |
|
| Q |
222 |
tctttgtatacatactcatcttgaataactaactcttccatattcattctctttaagggttattgaaatatgtg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
2276484 |
tctttgtatacatactcatcttgaataactaactcttcgttgttcattctctttaagggttattgaaatatgtg |
2276411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University