View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_low_58 (Length: 296)
Name: NF5931_low_58
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_low_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 54 - 283
Target Start/End: Complemental strand, 55695280 - 55695048
Alignment:
| Q |
54 |
tgctgattctgtttcagtagtttctttagcctcttcagctgatacttcctctttcacttcgaccttttcaggttccgcgttctctacctctggcttggct |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55695280 |
tgctgattctgtttcagtagtttctttagcctcttcagctgatacttcctctttcacttcgactttttcaggttccgggttctctacctctggcttggct |
55695181 |
T |
 |
| Q |
154 |
tcctcagttacttgtgtactctcagcttcaactggaacttcagtttctcctttctccactgctactacttcttcggtggtggccggttctgaagtgggaa |
253 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
55695180 |
tcctgggttacttgtgtactctcagcttcaacgggaacttcagtttcttcattctccactgctactacttcttcggtggtggctggttctgaagcaggaa |
55695081 |
T |
 |
| Q |
254 |
cctcagagccc---ggtgttgtttcctcgacct |
283 |
Q |
| |
|
|||| ||| || ||||||||||||||||||| |
|
|
| T |
55695080 |
cctcggaggccggtggtgttgtttcctcgacct |
55695048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 55695405 - 55695284
Alignment:
| Q |
1 |
atcactttttatgcttctgtggtggttacttcttccactggtactgctatggctgctgattctgtttcagtagtttctttagcctcttcagctgatactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
55695405 |
atcactttttatgcttctgtggtggttacttcttccactggtgctgctattgctgctgattctatttcagtagtttctttagcctcttcagttgatactt |
55695306 |
T |
 |
| Q |
101 |
cctctttcacttcgaccttttc |
122 |
Q |
| |
|
||||||| ||||||| ||||| |
|
|
| T |
55695305 |
cctcttttgcttcgactttttc |
55695284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University