View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_low_60 (Length: 289)
Name: NF5931_low_60
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_low_60 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 14 - 278
Target Start/End: Complemental strand, 22042561 - 22042297
Alignment:
| Q |
14 |
atgtgcacaggaattcggcgaagtgaacccaaagtttcttgaagaattcgacaatttgaaactagtttggaatctgatagatattaatggaaaaagtcac |
113 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
22042561 |
atgtgcacaagaattcggcgaagtgaacccaaagtttcttgaagaattcgatgatttgaatccagtttggaatctcatagatgttaatggaaaaagtcac |
22042462 |
T |
|
| Q |
114 |
catgtaactttcaacaattcagaaactctccctttactaactacaggatggactgccataagagatttttaccattttgaaggcattagaaaaattgtgc |
213 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
22042461 |
catgcaactttcaacaattcagaaactctccctttactaactacaggatgaactgccataagagatttttaccattttgaaggcatcagacaaattgtgc |
22042362 |
T |
|
| Q |
214 |
taaactatgttggccaaagccgattcataatgactcttggaaggacacttcattccactgatgat |
278 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22042361 |
taaactatgttggccaaacccgattcataatgactcttggaaggacacttcattccactgatgat |
22042297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University