View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_low_65 (Length: 274)
Name: NF5931_low_65
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_low_65 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 129 - 262
Target Start/End: Complemental strand, 42061688 - 42061559
Alignment:
| Q |
129 |
ggggccatgatacttgaataaacacatactacttctgtagacttgatctcaaacttaacagccactccaagaaagaatatgcatgcatccacataaaaca |
228 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42061688 |
ggggccatgatacttgaatacacacatactacttctgtagacttgatctcaaacttaacagccactccaagaaagaatat----gcatccacataaaaca |
42061593 |
T |
 |
| Q |
229 |
agttgcaattaacttataaaatgcatgaacatat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42061592 |
agttgcaattaacttataaaatgcatgaacatat |
42061559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 42061816 - 42061764
Alignment:
| Q |
1 |
aaaaaatttacacatttctttcttgcgtttcctataccatcaaacattacatg |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42061816 |
aaaaaatttacacatttctttcttgcgtttcctataccatcaaacattacatg |
42061764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University