View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_low_69 (Length: 260)
Name: NF5931_low_69
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_low_69 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 260
Target Start/End: Complemental strand, 742620 - 742373
Alignment:
| Q |
11 |
caaaggaagtatgaaacaccatcatcaagacatgggacgttgtagtagagtcccctttagagaaagtatatctcgattccctttgtacattcaaaattgt |
110 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
742620 |
caaaggaagtatgaaacaccatcattaaggcatgggacgttgtagtagagtcccctttagagaaagtatatctcgattccctttgtacattcaaaattgt |
742521 |
T |
 |
| Q |
111 |
atgtgcaaattttccaaaatttctcaaatatgtgcaatatactattttggatctggtgaaggagaaaatagtatgagggcatggacatatcgtgtaatgt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
742520 |
atgtgcaaattttccaaaatttctcaaatatgtgcaatatactattttggatccggtgaaggagaaaatagta--aggacatggacatatcgtgtaatgc |
742423 |
T |
 |
| Q |
211 |
atattaaaaatacgaccatgaacacgattagtgatgacatgattatttac |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
742422 |
atattaaaaatacgaccatgaacacgattagtgatgacatgattatttac |
742373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University