View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_low_78 (Length: 242)
Name: NF5931_low_78
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_low_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 38 - 166
Target Start/End: Complemental strand, 39790351 - 39790223
Alignment:
| Q |
38 |
aaacaagtggtgtgcacaatacacaacccataccatcattgcacggaaaaacaaatcacaaacatatctattttcggacaaacatgttactcaatacatg |
137 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39790351 |
aaacaaatggtgtgcacaatacacaacccataccatcattgcacggaaaaacaaatcacaaacatatctattttcggacaaacatgttactcagtacatg |
39790252 |
T |
 |
| Q |
138 |
ataagcttgttgaaataactagataactc |
166 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39790251 |
ataagcttgttgaaataactagataactc |
39790223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 39790479 - 39790441
Alignment:
| Q |
1 |
acttttttaattcacaatatcgaataagtcaaaggaaaa |
39 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39790479 |
acttttttaattcacaatgtcgaataagtcaaaggaaaa |
39790441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University