View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5931_low_78 (Length: 242)

Name: NF5931_low_78
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5931_low_78
NF5931_low_78
[»] chr4 (2 HSPs)
chr4 (38-166)||(39790223-39790351)
chr4 (1-39)||(39790441-39790479)


Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 38 - 166
Target Start/End: Complemental strand, 39790351 - 39790223
Alignment:
38 aaacaagtggtgtgcacaatacacaacccataccatcattgcacggaaaaacaaatcacaaacatatctattttcggacaaacatgttactcaatacatg 137  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
39790351 aaacaaatggtgtgcacaatacacaacccataccatcattgcacggaaaaacaaatcacaaacatatctattttcggacaaacatgttactcagtacatg 39790252  T
138 ataagcttgttgaaataactagataactc 166  Q
    |||||||||||||||||||||||||||||    
39790251 ataagcttgttgaaataactagataactc 39790223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 39790479 - 39790441
Alignment:
1 acttttttaattcacaatatcgaataagtcaaaggaaaa 39  Q
    |||||||||||||||||| ||||||||||||||||||||    
39790479 acttttttaattcacaatgtcgaataagtcaaaggaaaa 39790441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University