View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_low_79 (Length: 241)
Name: NF5931_low_79
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_low_79 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-128; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 44714834 - 44714604
Alignment:
| Q |
1 |
caggtgaggagtaccatatcgaagggtgtttctctcaacgtggttgcaaagtttttaacgcgatgaaggaaattgtggctgagatttatcgtaaagtgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44714834 |
caggtgaggagtaccatatcgaagggtgtttctctcaacgtggttgcaaagtttttaacgcgatgaaggaaattgtggctgagatttatcgtaaagtgga |
44714735 |
T |
 |
| Q |
101 |
ccccactacaggtaatacgcttgggaaggaagtgttctctctttgtgttaagcctggttttgatgctgcttttgcaatgggatttattctcgtccttgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44714734 |
ccccactacaggtaatacgcttgggaaggaagtgttctctctttgtgttaagcctggttttgatgctgcttttgcaatgggatttattctcgtccttgat |
44714635 |
T |
 |
| Q |
201 |
catatcagcggtgatgattcccttgatgatg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44714634 |
catatcagcggtgatgattcccttgatgatg |
44714604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 3 - 216
Target Start/End: Complemental strand, 44704129 - 44703916
Alignment:
| Q |
3 |
ggtgaggagtaccatatcgaagggtgtttctctcaacgtggttgcaaagtttttaacgcgatgaaggaaattgtggctgagatttatcgtaaagtggacc |
102 |
Q |
| |
|
|||||||||||||| || ||||| || |||||||||||| |||||| |||||||||| |||||||||| || ||||||||| |||| |||||||||| |
|
|
| T |
44704129 |
ggtgaggagtaccacattgaaggttgcttctctcaacgttgttgcacggtttttaacggaatgaaggaaaacgtagctgagattcatcgcaaagtggacc |
44704030 |
T |
 |
| Q |
103 |
ccactacaggtaatacgcttgggaaggaagtgttctctctttgtgttaagcctggttttgatgctgcttttgcaatgggatttattctcgtccttgatca |
202 |
Q |
| |
|
|||| |||||| || |||||| || |||||||| |||||||||||||||||||||||||| ||||| ||||| |||||||| |||||||||||||||| |
|
|
| T |
44704029 |
ccaccacaggtgttatgcttggaaaagaagtgttatctctttgtgttaagcctggttttgacgctgcctttgctatgggattcgttctcgtccttgatca |
44703930 |
T |
 |
| Q |
203 |
tatcagcggtgatg |
216 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
44703929 |
aatcaacggtgatg |
44703916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 165
Target Start/End: Original strand, 2278152 - 2278242
Alignment:
| Q |
75 |
gtggctgagatttatcgtaaagtggaccccactacaggtaatacgcttgggaaggaagtgttctctctttgtgttaagcctggttttgatg |
165 |
Q |
| |
|
|||||||||||| |||||||||||||||||| || || || ||||||||| ||||||||| ||||||||| | |||| |||||||| |
|
|
| T |
2278152 |
gtggctgagattcgtcgtaaagtggaccccaccactagtgttatgcttgggaaagaagtgttcatgctttgtgttcaacctgattttgatg |
2278242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University