View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_low_87 (Length: 232)
Name: NF5931_low_87
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_low_87 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 214
Target Start/End: Complemental strand, 7716546 - 7716348
Alignment:
| Q |
17 |
cactattactagcaaacaaattaaatttcc-aagtactcaaattacataggaagcaacaaatgccaaaacaaacacaatttgaaaaacaccaacaggaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7716546 |
cactattactagcaaacaaattaaatttcctaagtactcaaattacataggaagcaacaaatgccaaaacaaacacaatttgaaaaacaccaacaggaac |
7716447 |
T |
 |
| Q |
116 |
atggtaaccagaagacttagaatgaacatcttgaatcatcactctaacaatcatcttttgtcctttctcacaatgtcctgatgcaccacttatgaagta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7716446 |
atggtaaccagaagacttagaatgaacatcttgaatcatcactctaacaatcatcttttgtcctttctcacaatgtcctgttgcaccacttatgaagta |
7716348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University