View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5931_low_92 (Length: 226)
Name: NF5931_low_92
Description: NF5931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5931_low_92 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 22 - 210
Target Start/End: Original strand, 24234317 - 24234512
Alignment:
| Q |
22 |
ttatagttgaaaatttgttgtatatgaacgaaatttttaactatagattatattttcaaccaccacttttaattatatttattctggatagagtagcaga |
121 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24234317 |
ttatagttgaaaatttgttgtatgtgaacgaaatttttaactatagattatattttcaactaccacttttaattatatttattctggatagagtagcaga |
24234416 |
T |
 |
| Q |
122 |
tatctttgtagattttaatcacatgagatgtag-------ttatgagacaccactatgggcaccaatcctagtagcaatttgaacttacttttcat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24234417 |
tatctttgtagattttaatcacatgagatgtagttatgacttatgagacaccactatgggcaccaatcctagtagcaatttgaacttatttttcat |
24234512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University