View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5932_high_25 (Length: 285)
Name: NF5932_high_25
Description: NF5932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5932_high_25 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 119 - 285
Target Start/End: Complemental strand, 51387587 - 51387421
Alignment:
| Q |
119 |
aatgtgattataaagtgatttagtgaggatttgttttgccgtnnnnnnnngtgatttgaacttgacatcaaaaaagttatttttaaaatgtaattattct |
218 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51387587 |
aatgtgattataaagtgatctagtgaggattggttttgccgtaaaaaaaagtgatttgaacttgacatcaaaaaagttattttcaaaatgtaattattct |
51387488 |
T |
|
| Q |
219 |
ttgatatatcaaaactaaattgaatgnnnnnnnnntgattttatattttttgatgtgagttctcatt |
285 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51387487 |
ttgatatatcaaaactaaattcaatgaaaaaaaaatgattttatattttttgatgtgagttctcatt |
51387421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University