View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5932_low_13 (Length: 370)
Name: NF5932_low_13
Description: NF5932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5932_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 18 - 360
Target Start/End: Original strand, 5285349 - 5285691
Alignment:
| Q |
18 |
ggttctatagttattttaaccaacttgggctactccagctctggtgaagtattgaattgcaagtatgcttttgttagcttctaataatttctttctagtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5285349 |
ggttctatagttattttaaccaacttgggctactccagctctggtgaagtattgaattgcaagtatgcttttgttagcttctaataatttctttctagtt |
5285448 |
T |
|
| Q |
118 |
gctacctacatcatatcatatagtataacttattgcatgaatgatgctgtcatagcattttttgtaatttctgattaatcatatctgatatgtacttttt |
217 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5285449 |
gctacctacatcatatcatacagtataacttattgcatgaatgatgctgtcatagcattttttgtaatttctgattaatcatatctgatatgtacttttt |
5285548 |
T |
|
| Q |
218 |
ctaggatcttcttaagaattacacttatgaatagaattgaaaagacggatcttgaaatcatgataaaaaagcacaaaagtactgcagttatgcttgaatt |
317 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5285549 |
ctaggatcttcttaagaactacacttatgaatagaattgaaaagacggatcttgaaatcatgataaaaaagcacaaaagtactgcagttatgcttgaatc |
5285648 |
T |
|
| Q |
318 |
cttaatattaatatgattatttgttctttctccagcacctatg |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5285649 |
cttaatattaatatgattatttgttctttctccagcacctatg |
5285691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University