View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5932_low_24 (Length: 301)
Name: NF5932_low_24
Description: NF5932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5932_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 34693654 - 34693357
Alignment:
| Q |
1 |
catttttagttgaattttttatcccctcaaaaaatatttatcttgggnnnnnnnagtgatgtgaattttccannnnnnnnacaaggctaattaaacaaca |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34693654 |
catttttagttggattttttatcccctcaaaaaatatttatcttggttttttttagtgatgtgaattttccattttttttacaaggctaattaaacaaca |
34693555 |
T |
 |
| Q |
101 |
caaaaaggaaacggaacaagaaaggcaaatctaattcataagaaagtaaattttcaatgcatcattctatgacttatgaattagcaaactggaatttgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34693554 |
caaaaaggaaacggaacaagaaaggcaaatctatttcataagaaagtaaattttcaatgcatcattctatgacttatgaattagcaaactagaatttgga |
34693455 |
T |
 |
| Q |
201 |
gagactttaaacttgagtataaaatttgcacacgaattttcttctcctaaagtataagtgatagagacattattttgagagttgaggtctttaatatt |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34693454 |
gagactttaaacttgagtataaaatttgcacactaattttcttctcctaaagtataagtgatagagacattattttgagagatgaggtctttaatatt |
34693357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University