View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5933_high_14 (Length: 345)
Name: NF5933_high_14
Description: NF5933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5933_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 9 - 325
Target Start/End: Complemental strand, 52242629 - 52242313
Alignment:
| Q |
9 |
atcacagaggaaatcagacgttgattttaatgatgtgtttgggggaccgccgcggaggaggtcatcggtgagtggaggagaggaaggtgaaacgggttgg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52242629 |
atcacagaggaaatcagacgttgattttaatgatgtgtttgggggaccaccgcggaggaggtcatcggtgagtggaggagaggaaggtgaaacgggttgg |
52242530 |
T |
 |
| Q |
109 |
tgtagttggcctcctccgcctgagagcgagaaaccggtgtttggtgaggatagtggagttaggaggagaagaaaaggaaaagatttctttgatgatatat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52242529 |
tgtagttggcctcctccgcctgagagcgagaaaccagtgtttggtgaggatagtggagctaggaggagaagaaaaggaaaagatttttttgatgatatat |
52242430 |
T |
 |
| Q |
209 |
ttggaggagaagattcacagtctcaaactccaagtgggtgttcaacaccaaagagacgtgatggtgctgctttcagtcctgctcttcgaccacttgcttc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52242429 |
ttggaggagaagattcacagtctcaaactccaagtgggtgttcaacaccaaagagacgtgatggtgctgctttcagtcctgctcttcgaccacttgcttc |
52242330 |
T |
 |
| Q |
309 |
ttctctccccccatcct |
325 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
52242329 |
ttctctccccccatcct |
52242313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University